FAQ

SANGER SEQUENCING & FRAGMENT ANALYSIS:

_

How do I submit my samples?

We prefer that you submit your samples with the DNA and primer premixed together. If you prefer that we add one of our universal primers, just submit the DNA and we will add the universal primer, but at additional cost to you. You must submit your samples in 500ul screw cap vials, or in 96 well plate format (please see our web site for info on submitting 96 well plates). The following 500ul vials are acceptable (please contact us with questions about the usability of other vials):
USA Scientific 1405-9799, 1405-9710 and 1405-9700 through 1405-9706
Fisher Scientific 02-682-559, 21-403-203
Krackeler Scientific, catalog number: 229-T338-2

Where do I mail my DNA samples?

Our mailing address is: Genomics Facility, 147 Biotechnology Building, Cornell University, Ithaca NY 14853

I do not work on the Cornell campus, how do I send the samples to you?

Most users send the samples via FedEx or US Mail. Be sure the tubes are securely closed; you may wish to secure the tops with Parafilm. Place the samples in a padded envelope or wrap them in bubble wrap to decrease the chance of them being crushed while in transit. We receive many crushed and open tubes, so please pack your samples in such a way that they will arrive at our facility in good condition. Also, be sure your name and order number are written clearly on the sample container. The address is: Genomics Facility, 147 Biotechnology Building, Cornell University, Ithaca NY 14853.
If you are at Weill Medical College, please see (http://weill.cornell.edu/research/research_support/core_facilities/dna_s...) for more information.

How do I premix my samples?

For standard plasmid templates mix 1ug DNA with 8 pmole primer in a total volume of 18 ul, per tube. (Remember that each tube must contain only one primer.) For other templates, please see our DNA Sequencing Handbook for concentration and volume requirements.

What universal primers can the BRC provide?

We have T7HT, T3HT, M13R, and M13F:
M13F 5'-TGTAAAACGACGGCCAGT-3'
M13R 5'-AACAGCTATGACCATG-3'
T7HT 5'-GTAATACGACTCACTATAGGGC-3'
T3HT 5'-AATTAACCCTCACTAAAGGG-3'

How much do I submit for a PCR product?

For a PCR product, use the following calculation: divide the length of the PCR product by 5 and this is the amount of DNA in nanograms that we need for each reaction. For example, a 400 bp PCR product would be 400/5 = 80 ng of DNA. Add 8 pmole of primer in a final volume of 18 ul and that is what you submit to us. For an unmixed sample to be used with a universal primer, place the 80 ng in a final volume of 10ul.

I have a PCR primer, will it work for sequencing?

It probably will, but not always. We need a Tm of between 55c-65c, 18-24 bases is best and the primer should not contain any hairpins or dimers. Be sure your PCR product is cleaned up very well, or your results will show an overlap of two sequences.

In what should I resuspend the DNA?

Resuspend the DNA in either dH2O or low concentration Tris. Do not use TE. The EDTA may cause problems with our reactions.

Do I have to provide my own size standard for fragment analysis?

Yes. For fragment analysis plates, you must supply your own LIZ size standard. You can purchase directly from Life Technologies (Applied Biosystems), or from the Life Technologies supply center in the Biotechnology Building.

What kind of plates do I provide my samples in for fragment analysis?

You must provide your samples to us in Applied Biosystems 96 or 384 well plates, or plates from other manufacturers that are identical to these. These must be able to loaded directly on our ABI 3730xl instruments.

The ordering system is so restrictive. Why can't I name my samples anything I want?

The limitations in file naming are necessary because of the data systems we use to process the information. As you know, there are certain limitations in the use of symbols in filenames and those limitations depend on the type of computer you are using. For example, Macs can't use ":" and windows can't use "" and unix can't use "/". In addition, symbols may have special meaning (the "." in windows for example) and the databases we use and some naming conventions we use internally either depend on or can't handle non alphanumeric characters. While we are using a conservative rule, we are confident that it minimizes that chances of problems related to the sample and file names that would result in delays and confusion for everyone.
In the past, we could accommodate more complex names because a technician would filter every name manually and remove the offending characters. This was too inefficient to continue and could cause confusion on the customer's end when they received data that was not named in the way they expected.
You may wish to name your samples very simply and keep a spreadsheet or handwritten notes linking the name you supply to us with your internal identifier. Then you can rename files for your own use. This should work quite well for small projects.
If you are working on a project for which you have a relatively sophisticated information management system on your end that may depend on file names, we would be happy to consult with you to establish a logical naming scheme and/or "glue" to integrate the data with with other information you are tracking.

What if I want to reuse a DNA and/or primer sample that has been used in DNA sequencing at your facility in the past?

You must submit new samples with each order. We discard samples on a weekly basis. There is not much left after we process the samples so we also do not return unused sample back to you.

Is there a discount for submitting many samples?

Generally no. We only charge you what it costs us to operate and we can not charge some people more for the same service. Prices drop according to our usage and prices will drop for everyone when we reach certain levels of service. In cases where a large project will help us realize true savings in operating expenses, we may be able to arrange something.

Can you handle large scale sequencing projects?

Yes we can. We have the machine capacity and staff to handle large numbers of samples. Please let us know if you plan on using our facility for a large project.

If I turn in a sample this afternoon, can I get the results tomorrow?

No! We sequence samples on a first come, first serve basis. Your samples will be processed when enough samples have been submitted to put together a full sequencing run. This usually only takes a day, but may take longer. Normal turnaround time is 1-3 days, but may be longer if we are busy.

How will I know when my results are ready?

You may log onto our web site at any time and check the status of your orders. You will also receive an email when your results are ready.

How do I download results?

Log in to the BRCO. Click the link for "sequencing results" in the upper right of every page in our BRCO online system. Select (click) an order from the list of "completed orders" that appears. locate the link that says "Download archive of entire order as a ZIP file". The file will begin downloading. The location of the download file and the appearance of any interactive prompts will vary by browser and platform. Note that you can also view a gif image of your traces or the text sequence online. links for those activities along with some information on the quality of your results are located below the link for the ZIP file.

How long are my sequences stored on this distribution system?

Our distribution system does not provide permanent storage for your sequences. Sequences will be removed after 30 days. A service charge will be applied if we are asked to retrieve sequences from our archives.

What is a ZIP file? How can I get my results from it?

A ZIP file is a type of file known as an archive. It takes the individual trace and text sequence files from your order and combines them into a single file. It also compresses the information to speed downloads. In order to extract the data you want from a zip file you need a special utility. There are several options for Macs, Windows and Unix. If you are not sure what you want, go to Aladdin Systems to download and install Stuffit Expander for the platform you need. After you install it, either your browser will automatically decode the file, or you can manually extract the information according to the instructions from Aladdin.

I cannot seem to download the ZIP file no matter what I try. The name is just gibberish and I get errors or the file is not a zip file!

If you are using certain "sub-versions" of internet explorer 5.5 for windows, you may experience this problem. We recommend that you update using the latest service pack or browser version (You can acquire these from http://windowsupdate.microsoft.com/). You may also use an alternative browser such as Netscape or Opera. If you are using a different browser and still experiencing problems, please let us know.

When I click on the link for the ZIP file or trace file, My browser complains about an 'unknown file type'. What do I do?

Click the 'Save File' button on the 'unknown file type' dialog. Double check the filename and the save location in the resulting dialog.

I am dissatisfied with my results. What happened?

The most common causes of poor results are wrong concentrations, dirty DNA, contamination, or incorrect priming site. We can conduct troubleshooting sessions to help you with any problems that you might have. Please contact us.

These are not my results. What should I do?

If you are on a computer shared with others, It is possible that someone has already logged into our system under their name. Logout and try logging in under your own name. For security reasons, please remember to logout each time you are finished.

How can I get a print-out of my order?

We suggest that if you want to print a copy of your order for reference, that you print the e-mail you receive. "Printer friendly web page" is an oxymoron and, while we could attempt to create something, we feel that the effort would be better spent elsewhere. The e-mail confirmation we provide should suffice as a permanant, printable record of the order.

How do I get a printout of my sequence?

Due to the large volume of samples that we process, we cannot print out your files for you. You can view, edit, and print your sequences by following the links on our web site. 

I installed the software and it still doesn't work. Why not?

You may have to tell your computer what application to use the first time you try to open an .ab1 file. If you double-click an .ab1 file and you get a window with a list of applications, try picking the viewing program you installed from the BRC Software Archive. If it is not in the list, you probably did not install it yet.

Can I just drag individual files onto the Macintosh File Utility?

Yes, you can drag files or folders onto it.

Why doesn't double-clicking .AB1 files work, even after I've run the Macintosh File Utility?

Most likely, you don't have the proper software installed to view the files. They can be found in the BRC Software Area.

Does the Macintosh File Utility work in Mac OS X?

It will work with Classic support, but will not run natively at this time.

I am using the gateway system from Gibco. Why isn't it working well?

We are finding problems with sequencing the gateway system. We believe it is because the regions flanking your insert is forming a secondary structure which is interfering with the sequencing enzyme. We have tried to find a fix but as yet have not. Sometimes the sequencing works, sometimes not. Gibco tech support has been of no help. The best thing to do is to use a primer which binds in your insert.

NEXT GENERATION SEQUENCING:

_

Are the Illumina adaptor sequences removed from the sequences I get in my fastq file?

No, the adaptor sequences are not removed by the Illumina pipeline we run. If the insert is short enough, the adaptor sequence may appear at the 3’ end of the reads. Also, if there are any “empty” adaptors in the data, i.e. no insert, you will see only the adaptor sequence. The fastqc tool can give you an estimate of how many of these empty adaptors there are in your data set.

For Illumina TruSeq adaptors, the adaptor at the end of read 1 will be the adaptor with the barcode sequence in it: (GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNN(NN)ATCTCGTATGCCGTCTTCTGCTTG). The length of the barcode sequence is 6 or 8 bp, depending on which TruSeq adaptors you use. If you have a read 2 (it was a paired-end run), the adaptor will be Illumina’s adaptor without the barcode: (AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTCGCCGTATCATT).

What coverage can I expect?

The coverage you can expect depends on the yield from the sequencer, the read length, and the number of samples pooled in a run. Illumina has a coverage calculator available at this link. Generally, to estimate the average coverage, multiply the yield (number of reads) times the read length, and divide by the genome (or transcriptome) size. Divide this number by the number of samples pooled.

How many samples can I pool per lane/run?

There is no limit to the number of samples you can pool, though Illumina's TruSeq DNA-seq and RNA-seq kits can use up to 24 barcoded adaptors, Illumina's small RNA kits can use up to 48 barcoded adaptors, and Illumina's Nextera kits can be used to barcode up to 96 samples.

How can I look at the quality of my NGS data?

There are several ways, but probably the easiest is to use the fastqc program, available for download from the Babraham institute. A link to their site is here. Once installed, this program analyzes the fastq (or fastq.gz) file for quality score by base, nucleotide content, over-represented sequences, etc. Otherwise, you can contact the Director of the Genomics Facility for more information on your run/data.

For user-created libraries, do you do any QC before sequencing?

Yes, we quantify the library using picogreen and run an aliquot on a bioanalyzer to estimate the average MW (and look for adaptor artifacts). Based on these values, we dilute to the appropriate concentration for the sequencing. If adaptor artifacts (i.e. empty adaptors) are found, a size selection may need to be done.